A comprehensive puzzle breakdown proving Frodo’s innocence in the killing of Lena Ivanova in the Find My Killer ARG puzzle.
Solved by the following detectives:
jtobcat, ziot, lia, lefevre, pogo, mattm, and zomperzon
The puzzle began with a tweet by frodo
The Website
One of the first things you see on the website in a note from Lena:
My name is Lena Ivanova.
If you’re reading this, two things are true. One, I’m dead. And two, the blockchain is in peril.
Satoshi Nakamoto, the creator of Bitcoin, is actually a group known internally as the Keepers of the Ledger, made up of 8 expert cryptographers from various professions.
For years I have been doing gain of function research on quantum computers to secure, or “quantum-proof”, the blockchain. I have tried to keep this secret from the world — even my fellow Keepers. This paranoia was for good reason. I’ve recently come to suspect a bad actor amongst us. Perhaps they wish to use the quantum computer for nefarious means — or maybe they just want me dead.
I now assign a non-negligible probability to my impending murder. Or, as they say: I fear for my life. As a result, I am safeguarding my quantum designs, along with the research I’ve gathered on each of the Keepers and their motivations.
I’ve encrypted it all behind seven puzzles, originally designed for each Keeper. Each puzzle leads to one unique string, and a consensus of strings (any 6 out of 7) is needed to gain access to my computer. That’s where you’ll find my quantum designs and, maybe, more evidence to make a conviction.
While I trust the Keepers most, I trust the crypto community, and their financial incentives to keep the blockchain safe, second-most. If this has been shared with you, it’s because The Keepers have failed to reach a consensus on my murder.
Use the quantum computer designs for good, and find my killer.
Here are the identities of the 8 keepers, and therefore the 7 potential suspects:
Chinedu Okonkwo, Historian
Emily Zhao, Evolutionary Biologist
Cobie, Economist
Rajesh “Raj” Nair, Computer Scientist
Sara Alvarado, Engineer
Thomas Kennedy, Philosopher
Morgan Torres, LawyerAnd me, Lena Ivanova, Physicist and, I suppose, decease
There is also another message left by Lena on the main site next to the painting.
This is Braille and it says: IF IT CONTAINS THE WORD GOD TRY APPENDING IT TO THIS DOMAIN. This is telling us that if we have the word “GOD” in a phrase, we should use it as an endpoint on the website.
When going to view the painting, it was slowly being revealed a small portion at a time.
The Painting
Here is the fully revealed painting in all of its glory:
Puzzle 1
We are given a rebus puzzle to start, where each image and equation represents a part of the final message:
bit + . + [lyric — ric] + [forward + sl + ash] + moon + [d + ash] + [in + vader + s]
Resulting in a link to the following website:
This is a shortlink for this website:
Which routed to a noun themed space invaders game. Reaching a score of 126 in the game reveals a phone number.
Calling the number gives a recording with the following message:
Are you watching closely? We used to send up at the sky and wonder at our place in the stars. Help me introduce a little anarchy, upset the established order. Now I am become death, the destroyer to worlds.
The message is a series of movie quotes with a word(s) changed:
We used to send up at the sky and wonder at our place in the stars.
Help me introduce a little anarchy, upset the established order.
Now I am become death, the destroyer to worlds.
This spells “send help me to l3nasupern0va@gmail.com”
Sending “help me” to the email address returns the following message:
Going to sound cloud as hinted and searching for malthusian fish finds the following song:
https://soundcloud.com/dick-charles-922431844/malthusian-fish
And opening the audio file in any spectrogram software reveals the final message:
Entering brewer’s benevolence successfully solves Cobie’s puzzle and gives them a set of files to identify the killer.
Puzzle 2
This puzzle starts with morse code:
— .- ..- . … — .. — — -. — -…
- — — . — …. .- — … .- -.-. .-. .. ..-. .. -.-. .
-.. — — . … …- . .-. — — -. . … . .- .-.. .-.. ..- -.. . .. — ..
Which decodes to
QUESTION: TO WHAT SACRIFICE DOES VERONESE ALLUDE?
We are given 12 circles representing the answer length which is THE LAMB OF GOD
Having the word GOD in it tells us it’s a new endpoint:
Here we are given a cryptogram and pictures of the pyramids
While there are some phonetic nuances in the cryptogram when decoding, it decodes to the riddle below
a ruler rose in southern dune
deep and strong his faith in amun
son by k and p lost in history’s sky
seek his name this pharaoh ____
Where the answer is piye
This leads to a page with a Google maps street view. A reverse image search helps identify the location and a jump over to google street view helps find the exact spot where you can look around. There are four RV campers behind you from this view.
The answer for this page is campervans.
Leading us to the final page:
The poem speaks of a lake that was once a race of 975 miles, but is now 998 miles long. With a little bit of Googling, you will discover this is referencing the Iditarod race with the riddle referencing a location called Finger Lake.
Race map:
Pass of the Rain:
Entering finger pass successfully solves Chinedu’s puzzle and gives them a set of files to identify the killer.
Puzzle 3
The third puzzle is a riddle with some misspelled words in it.
In the image you get some text with typos:
It was almosp too culd to thinc
Whan suddemly it kame
in a blink
A hurremdous thoughd
I completely fodgot
To weer sokks and skades
on the rink
This results in TOKENCONTRACT.
Looking at the contract on Etherscan:
https://etherscan.io/address/0x256fb2dd3d4e70728afb4f34e8fd5446623f84df#code
We have a function in the contract named getClue
This leads to:
This gives us an RSA encrypted message with the private key:
We can decrypt this using a simple RSA tool online such as https://www.devglan.com/online-tools/rsa-encryption-decryption:
This decodes to:
which president xkcd 504?
This is referencing the XKCD webcomic #504, giving us the answer of Thomas Jefferson:
https://www.explainxkcd.com/wiki/index.php/504:_Legal_Hacks
Entering the answer of jefferson brings us to a new puzzle:
These are inputs for the chemistry software PyMol.
First, identify that [Anti-methamphetamine single chain Fv in complex with MDMA] = https://www.rcsb.org/structure/3gm0
fetch 3GM0
next is to identify the interactions as specified “🖱A->🖱find-> 🖱🥧-🥧 interactions” in the menus
finally running
set_view (-0.460065514,0.515658975,-0.722796559,0.085886583,-0.784404993,-0.614276946,-0.883714974,-0.344684243,0.316593945,0.000000000,0.000000000,-17.040334702,11.842411041,20.648729324,8.775371552,-6309.035156250,6343.173828125,-20.000000000)
Gives a view with only 5.5 and 4.5 which fits the format given of _._ _._
Entering the answer of 5545 brings us to a final puzzle:
These are AI generated images referring to rule of law for Mesopotamia and the Code of Hammurabi where they used the currency of Shekels. Each image is referring to an act and the fee for it, which when calculated with the formula, you get 33.
X + 6Y + Z = __ _______
X = ship of 60 gur = 2 shekel
Y = veterinary service = 1/6 shekel
Z = fell a tree = half a mina = 30 shekel
Entering 33shekels successfully solves Morgan’s puzzle and gives them a set of files to identify the killer.
Puzzle 4
The fourth puzzle begins with an equation, but has an arrow pointing to a new area on the painting. Following that direction, we discover several more pieces.
Using the equation and the map, we can fill in the blanks to determine the missing pieces.
This gives us the following, key = hbpynwc
Here we have two cipher texts:
- voaw vj ulbgauepn xxjy uqb gxlq Pjl Cxrgat Sfhqbj
- Npsbvzpaxxlgdgdbg
Using a Vigenere cipher with the key we got from the equation, we can decipher these.
only in searching will you find The Bitter Lesson
goddidntwinthewar
This leads us to the next endpoint:
On this page, we are able to download a zip file. This zip contains a single image file (i.png):
Using a Magic Eye tool, you can get the following hidden image out:
- m = LSB(i)
- H = takemax
This is a hint that we have data hidden in the images’ LSB (least significant byte) which is a classic image steganography technique. Using planetcalc.com’s LSB stego tool, we can extract data from the i.png file.
Output (posted in a gist since it’s a large binary string):
https://gist.github.com/ziot/789cfeb07fd12be0a5d4e83458698cb5
This is a lot of binary data! Remember that we have The Bitter Lesson text unused from earlier in the puzzle. Now we use the binary as a grille cipher where we “takemax” meaning take the paired letter where a 1 falls when overlaid on the text.
This decodes to:
nukemap godsrdalesaeasuatataeeaest
Leading us to a new endpoint:
On this page, we have a download link that is a zip containing an xlsx document with references to nukes. Nukemap is a tool that allows you to test various settings of a nuclear explosion on top of Google maps to simulate the potential destruction.
Most of the findmykiller.xyz links were 404s, but there was one that was valid:
Here are the valid columns:
- 53798 findmykiller.xyz/gnQPBcDGXDU3Bb5PwUp6dLMoStpfSSfT
- 49999 North Korean weapon tested in 2009 (6 kt)
- 44691 Baleyara
- 60660 Casualties & fallout
- 85431 Fatalities
- 92172 Detonate
- 59289 Surface
Using these settings on nukemap and reading the number of fatalities gave the final answer
Entering 36480 successfully solves Rajesh’s puzzle and gives them a set of files to identify the killer.
Puzzle 5
At the bottom left of the painting, there is some digital leet code that has “INSPECT THE FOUR HUNTED BIRDS” in it. At the top of the painting, there are some birds with letters on them.
There are four guns shooting bullets towards the birds.
Drawing a line for each bullet, they hit four birds — H, T, M, and L, giving us “HTML”. This is telling us to look at the website page source. Reviewing the source, we can see:
<!DOCTYPE html><html a-message-from-the-birds=”bit.ly/the-hunt-continues” lang=”en” data-theme=”black” class=”bg-black text-white”><head>
A message from the birds is telling us to visit:
https://bit.ly/the-hunt-continues
This shortlink takes us to a new website:
https://www.circuit-diagram.org/circuits/b6624aa046a24a51ad910e85ed7f87eb
There is a diagram that links out to several new endpoints:
findmykiller.xyz/godscoloringbook
The first link provides a zip folder of 112 pieces of a puzzle. After reassembling the puzzle we were able to get this image of a signal graph.
findmykiller.xyz/sacredstructures
Provided an excel sheet with pre populated information, after a google search, we discovered the numbers were for specific lego bricks. Each brick has a specific color associated with it.
Since the main image is a circuit and this is the R value, we need to convert the colors to a 4 band resistor. We get 5, 8, 100Ohms .25 tolerance, so the R value is 5.8K Ohms
findmykiller.xyz/sacredsymmetries
This gives another excel file, this time it has a link to a video and a specific time stamp. You can hear birds in the video during the short time provided but nothing else.
Using the rest of the Tips, we have the App store, Merlin, Location marker, and Vigenere.
Searching the app store there is one called Merlin Bird ID. This app gives us the bird in the clip as eurasian blackbird. Lastly for Vigenere we have to refer back to the circuit. On the circuit there is a string tiznlheepdexoo, when used as the cipher text for Vigenere, and the key is eurasianblackbird, we get the answer as pointzeroseven
Now that we have all the values for the Circuit we have to determine what it means. We discovered this is an Op-Amp. After reviewing many sources explaining Op Amps, this one seems most valuable
Specifically, without a feedback loop, the op-amp would act like a comparator, providing high low values, or more commonly a zero or a 1.
We get the non-inverting value from the voltage divider where the output is between the 2 resistors. This formula is:
- Vout = (V + R2)/(R1+R2)
- Vout = 5800/(3300+5800) = .637 = the non inverting input on the circuit.
Taking the Vin value every .07 seconds and comparing the value to the .63, we get a high low value in binary which is the answer that can be entered at the following link
Entering 101101110111011 successfully solves Sara’s puzzle and gives them a set of files to identify the killer.
Puzzle 6
The lines in this puzzle are song lyrics with some words replaced by images:
With the bottom symbols as a key, the line of symbols at the top decodes to “PEOPLE SAY WE ARE PLAYING GOD MY ANSWER IS”. This is a start of a quote by James D. Watson. The rest of the quote is “IFWEDONTPLAYGODWHOWILL”
Any time we see the word GOD, we load it as an endpoint, leading us to:
Here there is a link to a pdf file to download
In it is a puzzle:
converting the decimal numbers to ASCII gives the following let
agcaccgaaccgtaaacctggtaaagcgaagcgcgctgccattaaaacaccgaatttctgattggccatacctaatttcgctaactggaaaacgcgtaaggcgaaaacgaaaccatttgctaaacccgcgcgaacagcccgagcgaataagcgtttaccgaacgctaagcggatgatattaacggctaaatgattagcagcattaacggctaatgcattcgctgcctggaataaagccatgcgccggaagattaactggaaaccaccgaacgc
which is DNA code which can be decoded here to give the following message:
STEP*TW*SEARCH*NTEFLIGHT*FR*LENA*GENETIC*TRANSPSE*
AFTER*ADDING*MISSING*CIRCLE*SHAPED*LETTER
the last line tells us to add the missing circle letter, or O, as there is no O in DNA cipher code to get the message:
STEP TWO SEARCH NOTEFLIGHT FOR LENA GENETIC TRANSPOSE
which leads to this noteflight song:
As clued by the description, this song has been inverted
Do you recognize this song? No? What if you transformed it…
C3 -> C5
D3 -> Bb4
A0 -> Eb7
And so on…
Once you have the true artist, go to step 3 in the paper.
Inverting all the notes as described gives this song:
Which can be identified as A Thousand Miles by Vanessa Carlton and we can now proceed to step 3.
Solving for the solution with the given values gives a final answer of 100.
Entering 100 successfully solves Emily’s puzzle and gives them a set of files to identify the killer.
Puzzle 7
Throughout the painting, several hands have been replaced with American Sign Language (ASL) clipart. Each hand represents one letter. Additionally, each hand has a number on it, indicating the order of which we must place the letters.
Example:
The numbered hands:
Any time we see the word GOD, we load it as an endpoint, leading us to:
On this page, we have a new puzzle to solve:
The password for the input is “XYZ” with each letter being its own puzzle to solve.
Puzzle 7.1
The first puzzle is a chess board, giving us “Rg5_____” to begin with:
Recreate the board, and see that Rg5 must be black’s move as white has no rooks left. Using a chess calculator, white’s next move is e5 and black wins with e2.
This gives us the solution for X.
X = c5e2#
Puzzle 7.2
The second puzzle is a series of numbers beginning with {140455116}. This is an ISBN number for a version of Plato’s The Republic by Penguin Classics.
https://www.amazon.com/Republic-Penguin-Classics-Plato/dp/0140455116
Using the following numbers as page, paragraph, line, word, letter, we are able to extract a phrase.
Y = THEOPENSOCIETY
Puzzle 7.3
The third puzzle gives us two mazes and indicates a right hand turn = 1 and left hand turn = 0
The larger maze results in the string 100011010011011010011011001010 and the smaller maze gives 0111001001. The image indicates to complete a matrix equation with the two to generate a final output as shown below wherethe last value should be 3.
This gives us the solution of 043 to the matrix
Z=04
XYZ
Putting the strings together, we get the solution for XYZ:
XYZ = c5e2#opensociety04
Entering c5e2#opensociety04 successfully solves Thomas’ puzzle and gives them a set of files to identify the killer.
Lena’s Computer
On Lena’s computer we learn to gain access we need to submit 6/7 strings
submitcodes — Gain access to my computer with a consensus of six strings — type: submitcodes string1 string2 string3 string4 string5 string6
Each set of evidence also contained a unique string for each of the 7 people.
Typing any 6 of these strings gives access to Lena’s computer:
submitcodes {niLJO,- Z:U,RR#_ -Zd@!)V_ PK@>MP0/ [0!:3<cm ^g1&+Le}
which gives the link to access her computer at:
There we receive a message and zip file with multiple pdf’s and text files.
If you have made it this far then I trust six of you have reached consensus on the identity of the bad actor. I believe there is a chance I can help you confirm who did it — if the murder was committed at my home. The ring signature you use to enter my house has a backdoor in it, which keeps track of your public key. If I was killed in my house, the killer would have happily signed the ring signature, comfortable in its anonymity. My Digital Ink Explosion logs will have just auto-downloaded to your computer. If you have information on my time of death, check the D.I.E. logs for a time-stamped entry matching my TOD.
I have designed a single-use SSH software which you can use to hack into anyone’s computer and check for a match with their public key.
Simply input who you think did it and the door log from my TOD in the form: hackremote Firstname PublickeyFromDoorLog
(Doorlog key is case sensitive).
Of course, I’ve encrypted the logs. To decrypt them, simply follow the instructions in the instructions.txt file.
Once you have decrypted the doorlogs, you can use the SSH software to find the killer once and for all — but to protect against a false consensus, it’s designed so that you can only use it once — so choose wisely.
Instructions.txt
This text file contained the following:
1. Create blockchain (case sensitive, all lowercase answers, numbers in number form)
2. Decrypt quantum designs (case sensitive, entire file)
3. Decrypt doorlogs (entire file)
This is telling us that we need to solve the individual PDFs to create a “blockchain”.
The Block Chain
There are 7 block puzzle PDFs and each of them have a sha256 hash at the top of them. Each of these sha256 hashes are the answer to a different block puzzle with one being a hash of the word “start”. This turns out to be the “chain”, telling you how to order the answers when working on the quantum design cipher. For now, we will talk about the solution to the block puzzles and talk about the hashes after.
Block — Chinedu
The first thing we do is figuring out the starting boundaries.
Measuring 6175 miles to the east, we can get an idea of what possible areas there are. This lands us somewhere around the northern tip of Africa if we want to get a hit in Indonesia or Australia. At this point it is manually looking for the shape of lakes to find one that matches.
With a little bit of time and luck, we find a lake that matches the shape:
https://www.google.com/maps/@-13.0387987,30.9091573,11z?entry=ttu
Measuring from his left hand, there is a four letter lake called Lake Poso 6175 miles away in Indonesia.
Answer: poso
Block — Morgan
The text refers to the Monty Hall Problem, https://en.wikipedia.org/wiki/Monty_Hall_problem. This can be summarized as you have three doors and there is a prize behind one of them. If you select a door and one of the other doors is revealed to you, should you keep the original door you selected or switch to the last door? This problem is based on probabilities — given that you have better odds selecting one of two doors versus one of three, you have better probabilities if you switch your door.
Given the question: What do you do? You selected door two, the host revealed door one, leaving us with door three. The answer to the problem is to switch to door three. Knowing that the SHA256 hashes at the top of each block PDF must contain the answer to this puzzle, we start to sha256 strings and see if they match any of the hashes.
Unfortunately, we could get no matches with sha256ing variations of “switch”, “switch to door three”, and a million other combinations. At this point, we assume that we are missing something. There is not much to this text other than that there are three misspelled/grammatically incorrect words: vary, your and two, which when concatenated without spaces gives the answer we want.
Answer: varyyourtwo
Block — Sara
This was a rubik’s cube laid out flat and we needed to find the steps to solve and provide them in standard notation. There are many tools to do so.
The solution provided is dlul’f’r’. We ran into an issue here no matter what we tried to do with the letters and spacing we could not get it to resolve to a proper hash. Someone realized the apostrophes in the Monty text was a slightly curved version and copied and pasted it giving us dlul’f’r’. This ended up being the correct version of the apostrophe to use as it resulted in the correct answer.
Answer: dlul’f’r’
Block — Cobie
Here is the table containing the information for the puzzle:
Usually ChatGPT is not great at solving puzzles, especially logic puzzles, but sometimes it can handle some basic logic and math. Giving ChatGPT the rules of the puzzle and the initial state, it tried to process it:
And eventually (multiple steps and a lot of text later), we get our final answer:
It looks like ChatGPT managed to figure it out this time. Given this, we know the solution is 3312 which gives us the answer.
Answer: igna
Block — Thomas
Asking ChatGPT about this one, it had some ideas:
- For the sequence a5 to a8 to c8 to a8 to a7 to c7:
- This sequence suggests a piece that can move vertically and horizontally. The only piece that fits this movement pattern is the Rook.
- For the sequence d5 to e8 to f6 to g8 to h5:
- This sequence implies a piece that can move in an extended L shape and also change directions radically between moves. This describes the movement of a Knight.
- For the sequence d1 to d4 to d3 to f4 to d3 to f1:
- This sequence suggests a piece capable of moving straight across rows, columns, and diagonals. The only piece that can do all of these is the Queen
ChatGPT also successfully mapped the sequences, but it did it upside down:
Answer: fmk
Block — Rajesh
cgol refers to “Conway’s Game of Life”. This block is telling you what the grid cell values are, what the initial pixels are, and what steps are required (+10 generations and 16 population size).
Plugging this into dcode’s GoL tool:
https://www.dcode.fr/game-of-life
This gives us the following grid:
Concatenating the characters, we get the answer.
Answer: a35s6hv
Block — Emily
We are given a set of islands numbered 1 through 11 and we have to figure out the name for island 10. We are also missing island 7 entirely.
If we split the island names up into pieces, we can start to see a pattern emerge:
The second and last column loops through “u-lius, to-nium, er-ania”. This means the 10th island fits the pattern “??ERANIA”. Each island is a crude representation of a body organ with the first two letters matching the first two letters of its equivalent organ as shown below.
- oral — orulius
- esophagus — estonium
- liver — lierania
- stomach — stulius
- gall bladder — gatonium
- pancreas — paerania
- X
- appendix — apulius
- small intestine — smtonium
- large intestine
- rectum — reulius
Therefore the missing letters of the island come from Large Intestine to create the full island name of LAERANIA
Answer: laerania
Quantum Designs.txt
This text file contained the following, the ciphertext truncated due to its length:
The Pseudo Code
The code for GenerateKey is LaTex script, converting it into an image:
Some immediate observations from this if we reference the rest of the text file:
- There is a function named GenerateKey that takes the input “BlockchainSolutions”
- The comment on one of the sha512 function calls is that the index into BlockchainSolutions refers to “solution to block in chain”
- The script creates a concatenated list of sha512 hashes by initially sha512ing the puzzle answers. It loops through 5 times and references the previous iterations hash, so you must have the correct answers for a full decode. However, the very beginning of the key will begin with sha512 of the first answer. If we can get a partial decode, then we can fully decode it
- We need to figure out the order to put the answers to generate the correct key
The Block Chain Order
Now that we have all of the answers to the block, we need to put them together in the correct order. Each of the PDFs contained a sha256 hash validating our answers, but also giving us the order. In addition to our answers, we have a sha256 hash for the word “start”, indicating that it is the beginning of our chain.
Concatenating the answers using this chain gives us the ordering we need to generate the key.
The Script
Rewriting the pseudo code into Python, we land on the following:
https://gist.github.com/ziot/ba0fb4e10cf3280a28ad33f509348046
Unfortunately, we don’t know if Sha512 is from the Sha2 or Sha3 library, so we have to try both of them. Running this script, we get the following keys out:
- Sha2: https://gist.github.com/ziot/0ccd7edcc8602c9d33b20e8446dce6a5
- Sha3: https://gist.github.com/ziot/060bdc2b05bfcf8dea673fa850fe6976
Vigenere Cipher
We are told that it is a Vigenere cipher with some specific instructions. Although it’s possible to try to code it yourself, the settings are worded the same as on the Cryptii tool:
Unfortunately, neither of the keys work against the ciphertext to give us legible text output. Given our understanding of the code, we should at the very least be getting a partial decoded answer out at the beginning. We know that sha512(poso) must be the beginning of our key. This means that we either have faulty input or a misunderstanding of the pseudo code.
Going back to the instructions, we make an observation:
2. Decrypt quantum designs (case sensitive, entire file)
Putting the whole text file in as the ciphertext, we get readable plaintext out after the initial instructions:
Resulting output:
https://gist.github.com/ziot/f093c5784463df70144611b1850c337c
which is a set of entangled particles A/B.
Door Logs
Referring to the instructions, we must use doorlogs.csv and the doorlog-entanglements together to solve this puzzle.
The doorlogs.csv:
The doorlog-entanglements is a list of pairs named particleA and particleB. The first thought is that we have to pull the values from the Row/Column (x,y). Doing this results in a string like this:
7711111001700762201050077777761401735371003010171758AB_Q68070YT608T6/440004_5_T43_8A891_U9127J/64L0NO/N3_06040T/_80483T0O_068041KTEEZ8359GTNP2680TKG005E4_I5766_GT7G67NV_2YQS2V__40660007_O0505_3_000BT06_L1A406561_18LT48_F41_7CPS094P7Q8PR060034_24G4_06L60_/VMP07OH8
Thinking more about it, we write a script to visualize what cells particle A and B are being pulled from.
doorlog.py
This is a particularly interesting layout that is clearly intended as part of the puzzle. Unfortunately, it’s still nothing readable:
Given that this is a puzzle about quantum entanglement, we thought it might be interesting to switch the pair values.
doorlog2.py
Now we have something to work with!
Looking closely to the data, we can see some patterns:
- The first line is saying “ENTRY LOGS JAN ??? FEB ?????”
- The second line should be all spaces
- The third line is saying PUBLICKEY / TIMESTAMP
- The 12th column is supposed to be slashes.
- The area on the left of the /’s are the public key
- The area on the right of the /’s are the timestamp
It’s clear that not all of these cells are meant to be switched. The pairs are entangled, but we do not know what state they are in. We must go through each pair individually to see if it should switch or stay to determine the full output.
Knowing the format is a door code and a unix timestamp, it is feasible to know exactly which state the particles are in to properly give the final output.
Going through and switching them to their correct states, we get the following:
From the evidence, we know a few things:
- We know TOD is Feb 9 between 0400–0500
- We know that the last person to access the door was the person who found the bodies, so it is likely that the second to last row is the one we need
The timestamp on line 21 is 1707451740:
This timestamp is within the range of what we are looking for. So we now know the door code of the killer, all that’s left is to determine who did it to make an accusation and verify.
The Evidence Files
Solving each puzzle will lead to a subset of the 21 pieces of evidence which helps narrow down who the murderer is with the information in the introductory letter.
Most of it is noise, but some information can be used to eliminate suspects.
Dr. O was present at a Virgin Galactic launch on Feb 9 at 1 PM which is the day of the murder [17A]. Lena was murdered between 4 and 5 AM that morning. While it is possible for Dr. O to kill Lena and then go to the launch, it wouldn’t make sense for Dr. O to choose that specific day to kill Lena.
Emily has a crippling fear of reptiles as mentioned in her Quantumphobia article [5B]. Lena has a green iguana in her apartment according to the complaint filed by Thomas [13A]. Even though she was Lena’s ex and thus likely would have had the code to Lena’s apartment, the iguana being there ruled Emily out.
Cobie is Lena’s step-sibling [7A]. We didn’t find any evidence that indicated they could not have committed the murder.
Raj faints at the sight of blood [10A]. The crime scene was described as a “bloody scene” in the introduction letter and it was decided he likely could not commit the murder and get away before the housekeeper arrived.
Thomas, like Cobie, had no evidence that indicated he could not have committed the murder.
Morgan is possibly disabled in some way based on her reactions to Lena taking the disabled parking space [18B]. It’s not clear how she is disabled, but if she requires the handicapped parking spot it suggests reduced mobility which also lowers her suspicion.
Sara has sensitive hearing [19A]. The murder weapon was described as a gun. A person with sensitive hearing likely would not be a regular user of firearms.
After looking at the evidence, our chief suspects were Cobie and Thomas. Thomas was determined to be slightly more suspicious than Cobie since he was an apparent animal rights extremist with a short temper. He also mentioned the book “Of Mice and Men” in the podcast interview which ends with a person shooting another one in the back of the head, much like how Lena was killed.
This gave us a strong feeling that we suspected Thomas the most, but no smoking gun. Thankfully, Lena built a backdoor to check the public key of the signature used to enter her house to concretely prove it was Thomas who entered her house at the time of death.
Final Accusation
With this information, we made our final accusation of Thomas as the killer and their door code.
hackremote Thomas 36A38603KNCC
It has been confirmed, the door code matched Thomas’ key, thus proving them as the killer and certifying Frodo as innocent.
